search for




 

Effects of Bamboo Salt with Sodium Fluoride on the Prevention of Dental Caries
J Dent Hyg Sci 2019;19:288-93
Published online December 31, 2019;  https://doi.org/10.17135/jdhs.2019.19.4.288
© 2019 Korean Society of Dental Hygiene Science.

Hye-Jin Lee1 ,†, A-Reum Park2 , and Han-Na Oh2

1Department of Dental Hygiene, Howon University, Gunsan 54058,
2Department of Dental Hygiene, Wonkwang Health Science University, Iksan 54538, Korea
Correspondence to: Hye-Jin Lee, https://orcid.org/0000-0003-3923-0447
Department of Dental Hygiene, Howon University, 64 Howondae 3-gil, Impi-myeon, Gunsan 54058, Korea
Tel: +82-63-670-7775, Fax: +82-63-670-7779, E-mail: qorrha12@daum.net
Received November 5, 2019; Revised December 4, 2019; Accepted December 9, 2019.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Background:

Dental caries is one of several prevalent oral diseases caused by dental plaque biofilms. This study evaluated the anti-cariogenic effects of a bamboo salt (BS) and sodium fluoride (NaF) mixture on oral bacteria.

Methods:

The effects of several mixtures of NaF and BS on acid production, growth, and adhesion to glass beads of Streptococcus mutans, and their anti-cariogenic properties were investigated. The growth of S. mutans was measured according to optical density at 3, 6, 9, 12, 15, 18, and 24 hours after treatment using spectrophotometry at a wavelength of 600 nm, while pH was measured using a pH meter. Adhesion of S. mutans was measured according to the weight of glass beads from each group before and after incubation. Gene expression was measured using real-time polymerase chain reaction. Acid production and growth patterns of S. mutans were compared using repeated measures analysis of variance, followed by Scheffe’s post-hoc test. The Kruskal–Wallis test was used to compare adhesion, followed by the Mann–Whitney test. Gene expression in the experimental and control samples was compared using the Student’s t-test.

Results:

Growth, acid production, and adhesion of S. mutans were inhibited in all experimental groups. Expression of gft and fructosyltransferase in S. mutans was inhibited in all groups. A mixture of NaF and BS significantly reduced growth, acid production, adhesion, and gene expression of S. mutans compared with the other groups.

Conclusion:

Results of the present study demonstrated that a mixture of NaF and BS was useful as a mouth rinse in preventing dental caries.

Keywords : Bamboo salt, Dental caries, Sodium fluoride, Streptococcus mutans
Introduction

Dental caries is defined by dissolution of the tooth surface by acid produced from cariogenic microorganisms, especially Streptococcus mutans1). One significant characteristic of S. mutans in caries development is its ability to adhere to the tooth surface. S. mutans produces extracellular glucosyltransferase (gtfB, gtfC, gtfD, and fructosyltransferase (ftf) in the presence of sucrose, which are important in the formation of plaque and in the processes leading to dental caries2). To prevent dental caries and periodontal disease, it is essential to inhibit the formation of dental plaque on tooth surfaces. In this context, antimicrobial agents could serve as a valuable complement to mechanical plaque removal.

Bamboo salt (BS) is a Korean traditional salt. It is prepared by packing bay salt in bamboo, then baking it nine times in high heat using pine firewood. Through this process, the impurities in the bay salts are removed while its inorganic contents, including calcium, potassium, copper and zinc ions, and alkalinity, are increased compared to sun-dried salts (SDS)3). BS is known to have therapeutic effects for ailments including viral and bacterial infections, and inflammatory disorders4). The remineralization effects of BS on incipient artificial enamel caries have also been described5). Thus, BS can be considered a useful anti-microbial agent for the inhibition of dental plaque.

Sodium fluoride (NaF) is considered to play an important role in the prevention of dental caries, primarily due to its remineralization effect on decalcified tooth surfaces. Another advantage of fluoride is its ability to decrease acid formation in dental plaque, especially by S. mutans. Several studies investigating the effect of mouth rinses of diverse chemical composition(s) demonstrated that compound substances of NaF and other chemical agents are able to inhibit the metabolic activity of microorganisms in the dental biofilm6-8). The combination of BS and NaF is used as a component of dentifrice for the prevention of dental caries in Korea. A previous report described the remineralization effect of the combination of BS and NaF5); however, no study has determined its anti-microbial activity and mechanism of action in the inhibition of S. mutans, which is a pathogenic oral microorganism. As such, studies are needed to evaluate the antimicrobial activity and the mechanism of the anti-microbial effect of the combination of BS and NaF on S. mutans.

The objective of the present study, therefore, was to investigate the anti-microbial effect of NaF and BS, and whether NaF and BS can modify the cariogenic properties of S. mutans, including growth, acid production, and adhesion.

Materials and Methods

1. Preparation of solution

BS was provided by Insanga Food Inc. (Insanga Bamboo salt 9; Insanga, Hamyang, South Korea). BS (3% and 5%) was used in this study, and has previously been shown to inhibit the growth of S. mutans effectively9). NaF was purchased from Sigma-Aldrich (St. Louis, MO, USA). NaF (0.02% and 0.05%) was used in this study as a mouth rinse solution.

2. Measurement of Streptococcus mutans growth and acid production

S. mutans, American Type Culture Collection accession number 31,989, was used in this study. S. mutans was inoculated in brain heart infusion (BHI; Difco, Detroit, MI, USA) broth and incubated at 37°C for 24 hours. The optical density (OD; i.e., absorbance) of each culture was then measured at a wavelength of 600 nm to calculate the number of S. mutans to use in the experiments (1.6×108 colony forming units/ml).

BHI broth containing 10% glucose and different concentrations of NaF and BS mixture (3% BS, 0.02% NaF, 0.05% NaF, 0.02% NaF+3% BS, and 0.05% NaF+3% BS) was prepared. The growth of S. mutans was measured at 3, 6, 9, 12, 15, 18, and 24 hours using spectrophotometry (EZ Read 400; Biochrom, Cambridge, UK) according to OD at a wavelength of 600 nm (OD600). pH was measured at 2, 4, 8, 12, 16, 20, and 24 hours using a pH meter (920A; Thermo Orion, Beverly, MA, USA).

3. Analysis of adherence properties

BHI agar broth containing 10% glucose and different concentrations of NaF and BS mixture (3% BS, 0.02% NaF, 0.05% NaF, 0.02% NaF+3% BS, and 0.05% NaF+ 3% BS) was prepared. The weight of glass beads for each group was measured, and then 5 ml of experimental solution was poured onto the beads in each group. The mixture was incubated at 37°C for 24 hours and the experimental solution was removed, followed by addition of 75% ethanol to the plate. After drying, the weight of the glass beads was measured10). The experiment was performed in triplicate.

4. Measurement of bacterial gene expression using real-time polymerase chain reaction

Total RNA was purified using a commercially available kit (RNeasy Mini Kit; Qiagen, Venlo, The Netherlands). The primer sequences are provided in Table 1. Polymerase chain reaction conditions included an initial denaturation at 95°C for 15 minutes, followed by 40-cycle amplification consisting of denaturation at 94°C for 15 seconds and primer annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds. The expression levels of gtfB, gtfC, gtfD, and ftf were normalized using the 16S ribosomal RNA gene as an internal standard.

Nucleotide Sequence of RT-PCR Primers for Genes

Gene descriptionDirectionNucleotide sequence (5’-3’)
gtfBForwardAGCAATGCAGCCATCTACAAAT
ReverseACGAACTTTGCCGTTATTGTCA
gtfCForwardGGTTTAACGTCAAAATTAGCTGTATTAGC
ReverseGGTTTAACGTCAAAATTAGCTGTATTAGC
gtfDForwardCACAGGCAAAAGCTGAATTAACA
ReverseGAATGGCCGCTAAGTCAACAG
ftfForwardAATCCCTATCAACCTCGACTGC
ReverseGCCTTTCTCCTGCAACCAAATC
16s rRNAForwardCCTACGGGAGGCAGCAGTAG
ReverseCAACAGAGCTTTACGATCCGAAA

RT-PCR: reverse transcription polymerase chain reaction, ftf: fructosyltransferase.



5. Statistical analysis

Data analysis was performed using SPSS ver. 18.0 (IBM Corp., Armonk, NY, USA). Repeated measures ANOVA was used for acid production and growth patterns of S. mutans, followed by Scheffe’s post-hoc test. Adhesion was analyzed using the Kruskal–Wallis test, followed by the Mann–Whitney test. Differences in gene expression in the experimental and control samples were analyzed using the Student’s t-test.

Results

1. Effects of NaF and bamboo salt on the acidogenicity of Streptococcus mutans

After 24 hours, the pH value of all experimental groups was >6.5 and exhibited significantly increased values compared with the control group. pH reduction was lower in the 0.02% NaF+3% BS and 0.05% NaF+3% BS groups compared with the other groups (p>0.01) (Table 2).

Change of pH in Culture Medium after the Incubation

Time (h)Group*

Control (BHI)a3% BSd0.02% NaFb0.05% NaFc0.02% NaF+3%BSe0.05% NaF+3%BSe
07.18±0.007.35±0.007.20±0.017.18±0.007.33±0.017.35±0.00
27.18±0.007.35±0.007.16±0.007.15±0.007.31±0.017.31±0.01
47.09±0.007.26±0.007.14±0.007.15±0.007.29±0.007.28±0.00
87.01±0.007.25±0.007.08±0.007.15±0.007.24±0.007.25±0.01
126.71±0.017.24±0.006.95±0.017.15±0.007.24±0.007.24±0.01
165.30±0.007.21±0.036.82±0.007.12±0.017.25±0.017.26±0.00
204.30±0.007.08±0.006.71±0.007.08±0.017.18±0.007.22±0.02
244.18±0.017.08±0.016.58±0.017.08±0.017.18±0.007.21±0.01

Values are presented as mean±standard deviation.

BHI: brain heart infusion, BS: bamboo salt, NaF: sodium fluoride.

*p<0.01, by repeated measures ANOVA.

a,b,c,d,eThe same letter indicates no significant difference by Scheffe.



2. Inhibitory effects of NaF and bamboo salt on the growth of Streptococcus mutans

After 24 hours, the growth of S. mutans was inhibited by 50% and 75% compared with that of the control group when treated with 0.02% NaF+3% BS and 0.05% NaF+ 3% BS, respectively. The inhibitory rates were 25% and 50%, when treated with 0.02% NaF and 0.05% NaF, respectively (p>0.01) (Table 3).

Inhibitory Effects of BS and NaF on the Streptococcus mutans Growth

Time (h)Group*

Control (BHI)a3% BSb0.02% NaFb0.05% NaFc0.02% NaF+3%BSc0.05% NaF+3%BSd
00.06±0.000.06±0.000.06±0.000.06±0.000.06±0.000.06±0.00
30.06±0.000.06±0.000.06±0.000.07±0.010.06±0.000.06±0.00
60.07±0.000.07±0.000.07±0.000.07±0.000.07±0.000.06±0.00
90.20±0.000.10±0.000.15±0.000.09±0.010.09±0.000.06±0.00
120.31±0.000.22±0.010.22±0.000.11±0.000.13±0.000.07±0.00
150.29±0.010.24±0.000.22±0.000.14±0.010.16±0.000.07±0.00
180.28±0.020.24±0.010.21±0.000.14±0.010.16±0.000.07±0.00
210.28±0.000.21±0.020.20±0.000.14±0.010.15±0.000.07±0.00
240.28±0.000.22±0.000.19±0.000.14±0.000.15±0.010.07±0.00

Values are presented as mean±standard deviation.

BHI: brain heart infusion, BS: bamboo salt, NaF: sodium fluoride.

*p<0.01, by repeated measures ANOVA.

a,b,c,dThe same letter indicates no significant difference by Scheffe.



3. NaF and bamboo salt inhibited Streptococcus mutans adhesion to glass beads

The effect of NaF and BS on the adhesion of S. mutans to glass beads was examined. The combination of 0.05% NaF+3% BS significantly inhibited the adhesion of S. mutans (Table 4).

The Adhesion of Streptococcus mutans to Glass Beads

GroupWeight of glass beads (mg)Δm* (after-before)

BeforeAfter
Control (BHI)813.92±29.54815.01±29.531.08±0.09a
0.02% NaF803.27±70.86803.93±70.830.66±0.14b
0.05% NaF818.38±79.48818.85±70.830.46±0.19c
3% BS807.88±66.29808.45±66.330.56±0.19bc
0.02% NaF+3% BS805.08±41.88805.43±41.970.35±0.17cd
0.05% NaF+3% BS774.70±56.59774.95±56.560.25±0.07d

Values are presented as mean±standard deviation.

BHI: brain heart infusion, NaF: sodium fluoride, BS: bamboo salt.

*p<0.05, by Kruskal–Wallis test.

a,b,c,dThe same letter indicates no significant difference by Mann–Whitney test.



4. Expression of gtf and ftf

The expression of gtf and ftf was decreased in the NaF and BS group compared with the control group (Fig. 1). Messenger RNA expression of gtfB, gtfC, gtfD, and ftf was decreased in the NaF and BS group compared with the control group.

Fig. 1.

Effects of bamboo salt (BS) and sodium fluoride (NaF) on gtf and fructosyltransferase (ftf) expression in Streptococcus mutans. *p<0.05.


Discussion

Dental caries is caused by bacteria in dental biofilms. Pathogenic bacteria can adhere to tooth surfaces using an extracellular polymer termed the “glycocalyx”, leading to biofilm formation2). Because S. mutans has been established as the primary causative factor of dental caries, inhibiting S. mutans adhesion to the tooth surface could be one major approach to the prevention of dental caries11). In recent years, several anti-caries agents, such as NaF, tea polyphenols, triclosan and chlorhexidine, have been widely studied for preventing dental caries through the inhibition of biofilm formation12-14). In this study, we evaluated the anti-microbial effect of NaF and BS, and whether a mixture of NaF and BS could modify the cariogenic properties of S. mutans for prevention of dental caries was investigated.

BS has been known to have therapeutic effects on dental caries, inflammation, and viral infectious diseases3,5). The majority of table salts in Korea are purified salt (PS) and SDS. However, the quality of SDS is not adequately pure possibly due to seawater contamination, and PS is known to have a different component of biological electrolytes15). These facts have led to increasing use of “health- promoting” salts, such as BS, by the general population. Incipient artificial enamel lesions treated with BS exhibited increased surface hardness and mineral levels. The mixture of NaF and BS resulted in significantly increased remineralization effects on artificial enamel caries5).

Fluoride interferes with bacterial metabolism and inhibits bacterial growth16). This study also found that fluoride reduced S. mutans growth and acid production. Although the results demonstrated the inhibitory effect of NaF treatment on S. mutans, it is indefinite whether the treatments physiologically affected the function of other bacterial-related factors. As such, further studies are required to investigate bacterial interactions among dental biofilm microorganisms when NaF and BS are administered. This may lead to a deeper understanding of the bacterial community involved in dental caries pathology17).

One important factor inducing dental caries is acidity. The pH differences in BS- and NaF-treated S. mutans cultures were compared with those grown in BHI. The pH of BS-treated samples was similar to that of 0.05% NaF-treated bacterial cells; however, the mixture of NaF and BS led to a slight decrease in pH compared with samples treated with BS or NaF alone. It has been reported that the pH of BS can influence anti-inflammatory activity3). The BS and NaF mixture also resulted in a reduction of acid production. Thus, a combination of BS and NaF would result in increased anti-cariogenic activity.

In this study, it was found that various cariogenic conditions, such as acidogenicity and bacterial adhesion, were inhibited by treatment with NaF and BS. The NaF and BS group inhibited S. mutans growth and adhesion. Especially, the group with mixture of BS and NaF exhibited inhibitory effects that were more effective on the growth and adhesion of S. mutans than the BS, NaF, and control groups did. The mixture suppressed the expression of S. mutans biofilm-related gtfB, gtfC, gtfD, and ftf genes (Fig. 1). Among them, the expression of gtfB demonstrated the greatest reduction in the 0.05% NaF+3% BS mixture. gtfB is an important virulence gene associated with the pathogenesis of biofilm formation and dental caries18). More detailed gene expression profiling, however, is needed for a deeper understanding of the molecular mechanisms involved in the synthesis of biofilms in the presence of NaF and BS.

The 0.02% NaF+3% BS mixture was found to effect the activity of S. mutans by four routes: reduced adhesion of S. mutans to glass beads after incubation; reduced growth of S. mutans; repressed acid production by S. mutans; and modulation of the expression of specific genes including gtfB, gtfC, gtfD, and ftf. These findings demonstrate that a combination of NaF and BS can inhibit the cariogenic activity of S. mutans, and that a mouth rinse consisting of this mixture may be useful in preventing dental caries.

Notes

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Ethical approval

This project does not require IRB review because it is an experimental paper using commercially available microorganisms.

Acknowledgements

This study was supported by Howon University in 2019.

References
  1. Kuramitsu HK: Virulence properties of oral bacteria:impact of molecular biology. Curr Issues Mol Biol 3: 35-36, 2001.
    Pubmed
  2. Kuramitsu HK: Virulence factors of mutans streptococci:role of molecular genetics. Crit Rev Oral Biol Med 4: 159-176, 1993. https://doi.org/10.1177/10454411930040020201
    Pubmed CrossRef
  3. Shin HY, Lee EH, Kim CY: Anti-inflammatory activity of Korean folk medicine purple bamboo salt. Immunopharmacol Immunotoxicol 25: 377-384, 2003. https://doi.org/10.1081/iph-120024505
    Pubmed CrossRef
  4. Chung SY, Yi SY, Rheu HM: Pharmacological evaluation of bamboo salt. Biomol Ther 7: 178-184, 1999.
  5. Choi CH, Lee HJ, Oh HN, Hong SJ: Evaluation of the remineralization effect of bamboo salt and sodium fluoride solutions. J Korean Acad Oral Health 36: 7-12, 2012.
  6. Petersen FC, Assev S, Scheie AA: Combined effects of NaF and SLS on acid- and polysaccharide-formation of biofilm and planktonic cells. Arch Oral Biol 51: 665-671, 2006. https://doi.org/10.1016/j.archoralbio.2006.02.003
    Pubmed CrossRef
  7. Filoche SK, Soma K, Sissons CH: Antimicrobial effects of essential oils in combination with chlorhexidine digluconate. Oral Microbiol Immunol 20: 221-225, 2005. https://doi.org/10.1111/j.1399-302X.2005.00216.x
    Pubmed CrossRef
  8. Takarada K, Kimizuka R, Takahashi N, Honma K, Okuda K, Kato T: A comparison of the antibacterial efficacies of essential oils against oral pathogens. Oral Microbiol Immunol 19: 61-64, 2004. https://doi.org/10.1046/j.0902-0055.2003.00111.x
    Pubmed CrossRef
  9. Oh HN, Choi CH: Effect of bamboo salt on the caries activity of Streptococcus mutans. J Korean Acad Oral Health 40: 238-243, 2016. https://doi.org/10.11149/jkaoh.2016.40.4.238
    CrossRef
  10. Park YN: The effect of erythritol on gtf and ftf expression from Streptococcus mutans. Unpublished doctoral dissertation, Chonnam National University, Gwangju, 2011.
  11. Tarsi R, Muzzarelli RA, Guzmán CA, Pruzzo C: Inhibition of Streptococcus mutans adsorption to hydroxyapatite by low-molecular-weight chitosans. J Dent Res 76: 665-672, 1997. https://doi.org/10.1177/00220345970760020701
    Pubmed CrossRef
  12. Baehni PC, Takeuchi Y: Anti-plaque agents in the prevention of biofilm-associated oral diseases. Oral Dis 1: 9 Suppl: 23-29, 2003. https://doi.org/10.1034/j.1601-0825.9.s1.5.x
    Pubmed CrossRef
  13. Ooshima T, Minami T, Aono W: Oolong tea polyphenols inhibit experimental dental caries in SPF rats infected with mutans streptococci. Caries Res 27: 124-129, 1993. https://doi.org/10.1159/000261529
    Pubmed CrossRef
  14. Scheie AA: Modes of action of currently known chemical anti-plaque agents other than chlorhexidine. J Dent Res 68: 1609-1616, 1989.
  15. Kim YH, Ryu HI: Elements in a bamboo salt and comparision of its elemental contents with those in other salts. Yakhak Hoeji 47: 135-141, 2003.
  16. Bradshaw DJ, Marsh PD, Hodgson RJ, Visser JM: Effects of glucose and fluoride on competition and metabolism within in vitro dental bacterial communities and biofilms. Caries Res 36: 81-86, 2002. https://doi.org/10.1159/000057864
    Pubmed CrossRef
  17. Kuramitsu HK, He X, Lux R, Anderson MH, Shi W: Interspecies interactions within oral microbial communities. Microbiol Mol Biol Rev 71: 653-670, 2007. https://doi.org/10.1128/MMBR.00024-07
    Pubmed KoreaMed CrossRef
  18. Yamashita Y, Bowen WH, Burne RA, Kuramitsu HK: Role of the Streptococcus mutans gtf genes in caries induction in the specific-pathogen-free rat model. Infect Immun 61: 3811-3817, 1993.
    Pubmed KoreaMed


March 2020, 20 (1)
Full Text(PDF) Free


Cited By Articles

Funding Information